View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_56 (Length: 250)
Name: NF10559_low_56
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 29174934 - 29174754
Alignment:
| Q |
1 |
gctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggacctatctgttgttgcacccactccgtcggtgaccaacaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29174934 |
gctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggacctatctgttgttgcacccactccgtcgatgaccaacaaatt |
29174835 |
T |
 |
| Q |
101 |
gatctccataatccaagacaaaattgaacaaaaaccataaaagcgtgataccaatcctgtacaaatctagaaggcatttaa |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29174834 |
gatctccataatccaagacaaaatcgaacaaaaaccataaaagcgtgataccaatcctgaacaaatctagaaggcatttaa |
29174754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University