View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_57 (Length: 248)
Name: NF10559_low_57
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_57 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 14545098 - 14544863
Alignment:
| Q |
14 |
aaagaaagaaaggatttaagggggg-accataaattcatcaagctcgggatcggctccaaaacacgtggaaacaacaacgtctcttttacacatatcgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14545098 |
aaagaaagaaaggatttaagggggggaccataaattcatcaagctcgggatcggctccaaaacacgtggaaacaacaacgtctcttttacacatatcgtt |
14544999 |
T |
 |
| Q |
113 |
ttctcttcgaatctcttccaataaacttgcaatttcaggaggagcaccaacctaaacaatttattagcaattgcagaaattcgttaaactagattaagac |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
14544998 |
ttctcttcgaatctcctccaataaacttgcaatttcaggaggagcaccaacctaaacaatttattagcaattatagaaattcgttaaactggattaagac |
14544899 |
T |
 |
| Q |
213 |
cgtcacgttgcagagtagttacgatcaaacttagtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14544898 |
cgtcacgttgcagagtagttacgatcagacttagtt |
14544863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University