View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_59 (Length: 247)
Name: NF10559_low_59
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_59 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 31169858 - 31169619
Alignment:
| Q |
8 |
gatgaagcagaaaggttatgataaaacaaattcatactgggacaatcttcgcggaaaaccaagagactacgaaaattcaggtatggaatacaaaagaagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31169858 |
gatgaagcagaaaggttatgataaaacaaattcatactgggacaatcttcgaggaaaaccaagagactacgaaaattcaggtatggaatacaaaagaagg |
31169759 |
T |
|
| Q |
108 |
ttgtatagttttcataattagaaaccataatgtcaatcaaccaagatcttcctttattgttattccattccactaaatagtctttgaaatgatgataatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31169758 |
ttgtatagttttcataattagaaaccataatgtcaatcaaccaagatcttcctttattgttattccattccactaaatagtctttgaaatgatgataatt |
31169659 |
T |
|
| Q |
208 |
ttgcagaggaggaaataaaagaaagagcaaaaagagctgc |
247 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31169658 |
ttgcagaggaggaagtaaaagaaagagcaaaaagagctgc |
31169619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University