View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_61 (Length: 243)
Name: NF10559_low_61
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 31532666 - 31532891
Alignment:
| Q |
4 |
gaacaaagatctacgtggttcgacacttgttatg-tacatccacata-aacatctcaatataatgtatttactatctcaaaaagtattacaatgattgta |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31532666 |
gaacaaagatttacgtggttcgacacttgttacggtacatccacatataacatctcaatataatgtatttactatctcaaaaagtattgcaatgattgta |
31532765 |
T |
 |
| Q |
102 |
actcaatctcggattgtgtatcaacctacaatactcttactcaagagttaaaaataatgataacactcatatct--cacaagtgatgatcatccacacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
31532766 |
actcaatctcggattgtgtatcaacctacaatactcttactcaagagttaaaaataatgataacactcatatctcacacaagtgatgatcacccacacat |
31532865 |
T |
 |
| Q |
200 |
catctccctaggaccttgttagggat |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31532866 |
catctccctaggaccttgttagggat |
31532891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University