View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_71 (Length: 234)
Name: NF10559_low_71
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_71 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 40042673 - 40042889
Alignment:
| Q |
18 |
gtaagaactttcgtcgagcggtagagactaatctcttcttgaccttgccagtttttagataaatacaatttaacaaagttgcataactttggaactaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40042673 |
gtaagaactttcgtcgagcggtagagactaatctcttcttgaccttgccagtttttagataaatacaatttaacaaagttgcataactttggaactaatg |
40042772 |
T |
 |
| Q |
118 |
tttctagtccagcatagccaaaactagtgccgataacgcctcgtaggaagcggtgtctttcgccgtctttctccatgatagagtcctttcccatgagatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40042773 |
tttctagtccagcatagccaaaactagtgccgataacgcctcgtaggaagcggtgtctttcgccgtctttctccatgatagagtcctttcccatgagatg |
40042872 |
T |
 |
| Q |
218 |
aactgaggaagaaggcc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40042873 |
aactgaggaagaaggcc |
40042889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University