View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_76 (Length: 226)
Name: NF10559_low_76
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 7387266 - 7387068
Alignment:
| Q |
20 |
attgttgtaggggtgactggagatgtggaggccataggtcctcacgctatagttaagaggcattgttgtaatttgaaccgtagtatttatataagatatc |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7387266 |
attgttgtaggggtgaccggagatgtggaggccataggtcctcacgctatagttaagaggcattattgtaatttgaaccgtagtatttatataagacatc |
7387167 |
T |
 |
| Q |
120 |
aattacgaaactacaaatactattttgtcacaagcctacaca--cttagatgaacttcacatcaaacatgtgttccgttgttttgtgtttcttctctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
7387166 |
aattacgaaactacaaatactattttgtcacaagtctacacactcttagttgaacttcgcatcaaacatgtgttccactgttttgtgtttcttttctct |
7387068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University