View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10559_low_77 (Length: 224)

Name: NF10559_low_77
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10559_low_77
NF10559_low_77
[»] chr8 (2 HSPs)
chr8 (11-209)||(23279774-23279972)
chr8 (11-50)||(23400543-23400582)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 11 - 209
Target Start/End: Complemental strand, 23279972 - 23279774
Alignment:
11 agcataggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgnnnnnnnggtatctcattattgatatggttggtgttgctagggtt 110  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
23279972 agcattggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgtttttttggtatctcattattgatatggttggtgttgctagggtt 23279873  T
111 taaaatgcaaaccggataatagtggatgcgacatcacttttagtgtatcaattgcgtttcggtcggagtttatgtactttgaattgaaagagtattata 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23279872 taaaatgcaaaccggataatagtggatgcgacatcacttttagtgtatcaattgcgtttcggtcggagtttatgtactttgaattgaaagagtattata 23279774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 23400543 - 23400582
Alignment:
11 agcataggtgtttgctttgtagattaagatatttagtgtt 50  Q
    ||||| ||||||||||||||||||||||||||||||||||    
23400543 agcattggtgtttgctttgtagattaagatatttagtgtt 23400582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University