View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_84 (Length: 210)
Name: NF10559_low_84
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 42950411 - 42950233
Alignment:
| Q |
18 |
agtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagataacagtgttcgaatgctagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950411 |
agtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagataacagtgttcgaatgctagga |
42950312 |
T |
|
| Q |
118 |
aaagggaagataacggtgttatgtttcacatgcc-actaccttcatcttcttcaacagtatcaaacaaaatatcctttg |
195 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950311 |
aaatggaagataacggtgttatgtttcacatgccttataccttcatcttcttcaacagtatcaaacaaaatatcctttg |
42950233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 138 - 188
Target Start/End: Complemental strand, 2852033 - 2851983
Alignment:
| Q |
138 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2852033 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2851983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 138 - 188
Target Start/End: Complemental strand, 2904065 - 2904015
Alignment:
| Q |
138 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2904065 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2904015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University