View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10559_low_85 (Length: 204)
Name: NF10559_low_85
Description: NF10559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10559_low_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 6460647 - 6460479
Alignment:
| Q |
19 |
aaaaagtcgcaagacatgtgatgtagtaggaagattgttttccccaattatgccaacctttacttccaaagatgacaaaacctagatctactccaacaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6460647 |
aaaaagtcgcaagacatgtgatgtagtaggaagactgttttccccaattatgccaacctttacttccaaagatgacaaaacctagatctactccaacaag |
6460548 |
T |
|
| Q |
119 |
atcacctcgaactcgaacaaatttgaactcctcgaattcaaagctgcaaccctttaattcttcaactct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6460547 |
atcacctcgaactcgaacaaatttgaactcctcgaattcaaagctgcaaccctttaattcttcaactct |
6460479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 110
Target Start/End: Complemental strand, 200378 - 200330
Alignment:
| Q |
62 |
ccaattatgccaacctttacttccaaagatgacaaaacctagatctact |
110 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||| |||||||||| |
|
|
| T |
200378 |
ccaattatgccaacttttgccgccaaagatgacaaaacttagatctact |
200330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University