View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10560_high_8 (Length: 269)
Name: NF10560_high_8
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10560_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 259
Target Start/End: Complemental strand, 42394117 - 42393879
Alignment:
| Q |
21 |
cctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaatatttgaaaagatgattggtgaacgaa |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394117 |
cctgcgctggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaatatttgaaaagatgattggtgaacgaa |
42394018 |
T |
|
| Q |
121 |
tggtgaaggatgtagaaggaaaggaaagtgaaagtaaggannnnnnnnnnnnnnngttgaatttgaaggaggaaggtgattccaagacaccattcacaag |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394017 |
tggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaaggaggaaggtgattccaagacaccattcacaag |
42393918 |
T |
|
| Q |
221 |
cacccacgtgaaggctcttctcctggtatgctacctttg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393917 |
cacccacgtgaaggctcttctcctggtatgctacctttg |
42393879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 21 - 119
Target Start/End: Complemental strand, 42378202 - 42378104
Alignment:
| Q |
21 |
cctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaatatttgaaaagatgattggtgaacga |
119 |
Q |
| |
|
|||| |||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
42378202 |
cctgggttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgctttgatgggatatttgagaagatgattggtgaacga |
42378104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 176 - 259
Target Start/End: Complemental strand, 42378044 - 42377961
Alignment:
| Q |
176 |
gttgaatttgaaggaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttg |
259 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||| || |||| || || || |||||||| ||| ||||||||||| |||| |
|
|
| T |
42378044 |
gttgaatttgaaggaggagggtgattctaagacaccgtttacaaatactcatgttaaggctctactcatggtatgctacttttg |
42377961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University