View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10560_low_1 (Length: 545)
Name: NF10560_low_1
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10560_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 6e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 323 - 527
Target Start/End: Original strand, 1331175 - 1331372
Alignment:
| Q |
323 |
tcgttggttaatccctcggaaggttgtggaaaatgtagatcgtggtnnnnnnnnccc-gcatatgtttcaaagaaaacaattcataaatatgttgacaag |
421 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1331175 |
tcgttggttgatccctcggaagattgtggaaaatgtagatcatggtaaaaaaaaacctgcatatgtttcgaagaaaacaattcataaatatgttgacaag |
1331274 |
T |
 |
| Q |
422 |
gagaatacatacggcatagcatcctccaaggcttttgaagcgcgggtgcaacacttgttattactcatgttgaaaattttgttgatgatgacgacattgt |
521 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1331275 |
gagaatgcatacggcatagcatcctccaaggcttttgaagtgc--------cacttgttattactcatgttgaaaattttgttgataatgacgacattgt |
1331366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 39 - 99
Target Start/End: Original strand, 9455002 - 9455062
Alignment:
| Q |
39 |
gataatacaaaggaggaagataacgacaaagttagatctcatgaggaccaccatgaggagg |
99 |
Q |
| |
|
||||| ||| |||||||||||||||| || ||| |||||| ||||||||||||||||||| |
|
|
| T |
9455002 |
gataagacagaggaggaagataacgataatgtttaatctcacgaggaccaccatgaggagg |
9455062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University