View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10560_low_20 (Length: 249)
Name: NF10560_low_20
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10560_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 31691988 - 31691790
Alignment:
| Q |
10 |
atgaactccatgaatattgaattgattcaatgatcctctatccannnnnnnaatcgattcaagcattcaattatgacttttgaatcgattcaaacacata |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31691988 |
atgaactctatgaatattgaattgattcgattgtcctctatccatttttttaatcgattcaagcattcaattatgacttttgaatcgatttaaacacata |
31691889 |
T |
 |
| Q |
110 |
caaattgttttgaaatagttgaaaaaacatataacaccaaagactaacccaaaaatgatttacaacaaaggagatttgaaaaatcaaaggttttatgca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691888 |
caaattgttttgaaatagttgaaaaaacagataacaccaaagactaacccaaaaatgatttacaacaaaggagatttgaaaaatcaaaggttttatgca |
31691790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University