View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10560_low_20 (Length: 249)

Name: NF10560_low_20
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10560_low_20
NF10560_low_20
[»] chr8 (1 HSPs)
chr8 (10-208)||(31691790-31691988)


Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 10 - 208
Target Start/End: Complemental strand, 31691988 - 31691790
Alignment:
10 atgaactccatgaatattgaattgattcaatgatcctctatccannnnnnnaatcgattcaagcattcaattatgacttttgaatcgattcaaacacata 109  Q
    |||||||| ||||||||||||||||||| ||  |||||||||||       ||||||||||||||||||||||||||||||||||||||| |||||||||    
31691988 atgaactctatgaatattgaattgattcgattgtcctctatccatttttttaatcgattcaagcattcaattatgacttttgaatcgatttaaacacata 31691889  T
110 caaattgttttgaaatagttgaaaaaacatataacaccaaagactaacccaaaaatgatttacaacaaaggagatttgaaaaatcaaaggttttatgca 208  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31691888 caaattgttttgaaatagttgaaaaaacagataacaccaaagactaacccaaaaatgatttacaacaaaggagatttgaaaaatcaaaggttttatgca 31691790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University