View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10560_low_24 (Length: 227)
Name: NF10560_low_24
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10560_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42636252 - 42636023
Alignment:
| Q |
1 |
taaatacaagagacaaacaacacaaggtaaaatgattagtgttcttttgattagtgattgatacatgcatcacccatgcactgtgtatcatgttgcacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42636252 |
taaatacaagagacaaacaacacaaggtaaaatgattagtgttcttttgattagtgattgatacatgcatcacccatgcactgtgtatcatgttgtacct |
42636153 |
T |
|
| Q |
101 |
ttatgatcacatgcatagcattgtatctccaaatatac--------tgtacctttatgattacttgcatagcattgtatcacatgcatcgccaatgcact |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
42636152 |
ttatgatcacatgcatagcattgtatctccaaatatactatcatgttgtacctttatgattacttgcatagcatcgtatcacatgcatcaccaatgcact |
42636053 |
T |
|
| Q |
193 |
gatttacttcaatttttcccctatgctact |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
42636052 |
gatttacttcaatttttcccctatgttact |
42636023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 49601203 - 49601162
Alignment:
| Q |
156 |
ttgcatagcattgtatcacatgcatcgccaatgcactgattt |
197 |
Q |
| |
|
||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
49601203 |
ttgcatagcattgaatcacatacatcaccaatgcactgattt |
49601162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University