View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10560_low_27 (Length: 212)
Name: NF10560_low_27
Description: NF10560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10560_low_27 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 39 - 212
Target Start/End: Complemental strand, 32393105 - 32392932
Alignment:
| Q |
39 |
ttaaattagttctaactaaccaatgataataagcaagagaattaaacccccaaagttgttgattatgacaataactttagtgattaatcctccaacagat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32393105 |
ttaaattagttctaactaaccaatgataataagcaagagaattaaacccccaaagttgttgattatgacaataactttagtgattaatcctccaacagat |
32393006 |
T |
 |
| Q |
139 |
ccaaaagcttccctcatcacactagcatacgttgtctttacacctgcttctgtaaaacgcatgagaaaatccac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32393005 |
ccaaaagcttccctcatcacactagcatacgttgtctttacacctgcttctgtaaaacgcatgagaaaatccac |
32392932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 209
Target Start/End: Complemental strand, 32395149 - 32394994
Alignment:
| Q |
54 |
ctaaccaatgataataagcaagagaattaaacccccaaagttgttgattatgacaataactttagtgattaatcctccaacagatccaaaagcttccctc |
153 |
Q |
| |
|
||||||||||||||| || ||||||| ||||||||||||||| ||||||| ||| ||||| || | |||| ||||||| || |||||||||||| || |
|
|
| T |
32395149 |
ctaaccaatgataattaggaagagaactaaacccccaaagttagtgattataacacaaacttgagcgcttaaagctccaacggacccaaaagcttccttc |
32395050 |
T |
 |
| Q |
154 |
atcacactagcatacgttgtctttacacctgcttctgtaaaacgcatgagaaaatc |
209 |
Q |
| |
|
|| |||| || || || || ||||||| || | ||||||||||||||||||||| |
|
|
| T |
32395049 |
ataacaccagagtatgtcgtggttacaccagcatgtgtaaaacgcatgagaaaatc |
32394994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University