View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10561_low_12 (Length: 273)
Name: NF10561_low_12
Description: NF10561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10561_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 55688717 - 55688466
Alignment:
| Q |
18 |
tttctcttcttagaaacatccccagcagctttgggtgtagcacataaacttgcaacaccatcttccaaacctgcttctgcagcaaccttctcaaactgct |
117 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
55688717 |
tttctcttcttagaaacatctccggcagctttgggtgtagcacataaacttgcaacaccatcttccaaaccagcttccgcagcaaccttctcaaattgct |
55688618 |
T |
|
| Q |
118 |
tttggaggtttgaaatcacactctcggtcaaaaccacctcatcgattgaatttccaccattttcattggcagcattcttatccccgttctcagcagaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55688617 |
tttggaggtttgaaatcacactctcggttaaaaccacctcatcaattgaatttccaccattttcattggcagcattcttatccccgttctcagcagaatt |
55688518 |
T |
|
| Q |
218 |
catctcggaactcaaatcagaagcatcactcttcttattcttcttctcactc |
269 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
55688517 |
catctcggaactcaaaccagaagcatcactcttcttattcttcttcttactc |
55688466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University