View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10561_low_7 (Length: 327)
Name: NF10561_low_7
Description: NF10561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10561_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 137 - 242
Target Start/End: Original strand, 44525506 - 44525616
Alignment:
| Q |
137 |
catctgaacaaaaaaccatgggtcaatccctatagt-----tcaggcataggttattatcgggagcattcctttgcagattaaattcacacattacgata |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44525506 |
catctgaacaaaaaaccatgggtcaatctctatagtgtagttcaggcataggttattatcgggagcattcctttgcagattaaattcacacattacgata |
44525605 |
T |
|
| Q |
232 |
agccaaactaa |
242 |
Q |
| |
|
|||||| |||| |
|
|
| T |
44525606 |
agccaacctaa |
44525616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 44525371 - 44525438
Alignment:
| Q |
1 |
tgggtcccacttttttgcattatatcttgatccattttgtccttcatataagttccattcatcaagtt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44525371 |
tgggtcccacttttttgcattatatcttgatctattttgtccttcatataagttctattcaccaagtt |
44525438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 272 - 310
Target Start/End: Original strand, 44525616 - 44525654
Alignment:
| Q |
272 |
acgtaataaagtttttccatagctccttagctacattac |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44525616 |
acgtaataaagtttttccatagctccttagctacattac |
44525654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University