View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10562_high_1 (Length: 301)
Name: NF10562_high_1
Description: NF10562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10562_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 35 - 284
Target Start/End: Complemental strand, 7525918 - 7525669
Alignment:
| Q |
35 |
gtagtatggtattggtctgattatggagatggcaaatccacatcacccatatgtccatcaattattggctatctacttttccttgtccaatttttggaat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
7525918 |
gtagtatggtattggtctgattatggagatggcaaatccacatcacccatatgtccttcaattattggctatctactttttctaatccaatttttggaat |
7525819 |
T |
|
| Q |
135 |
ttaataacccataacaacacccatatgttcttcaattattggagagtaactaaatacctaaaaataatatctctacccaataaccacacagagcatgtcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525818 |
ttaataacccataacaacacccatatgtccatcaattattggagagtaactaaatacctaaaaataatatctctacccaataaccacacagagcatgtcc |
7525719 |
T |
|
| Q |
235 |
cccttttcctgatttatcggtcaaattcagttccccctccccatcatcat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
7525718 |
cccttttcctgatttatcggtcaaattcagttccctctccccatcttcat |
7525669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University