View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10562_high_2 (Length: 229)

Name: NF10562_high_2
Description: NF10562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10562_high_2
NF10562_high_2
[»] chr5 (1 HSPs)
chr5 (1-149)||(29093700-29093845)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 29093700 - 29093845
Alignment:
1 tttttggaacgcaacgccatatctatactactactactagatggtaattttgcgaagttgatactttaattggtttgtttagtaacaatacaacatgaaa 100  Q
    ||||||||||||| |||||||||||||||   ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||    
29093700 tttttggaacgcagcgccatatctatact---actactatatggtaattttgcgaagttgatactttaattggtttgtttagtagcaatgcaacatgaaa 29093796  T
101 aaacatctcacctctttcatattttggatcataatatttcataattgtg 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
29093797 aaacatctcacctctttcatattttggatcataatatttcataattgtg 29093845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University