View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10563_low_7 (Length: 227)
Name: NF10563_low_7
Description: NF10563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10563_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 209
Target Start/End: Complemental strand, 35393048 - 35392848
Alignment:
| Q |
17 |
gcacagatgacacttgttgaaagatttactgtaaagtataaacaaaacaaaac-----tccatcactgtatctgtccc---actcaactacttcactgat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35393048 |
gcacagatgacacttgttgaaagatttactgtaaagtataaacaaaacaaaacaaaactccatcactgtatctgcgtgggaactcaactacttcactgat |
35392949 |
T |
 |
| Q |
109 |
tcattcctctctctatcccttaaaccaaacatggaaatcattccgatccccgccgattcctacacactcggtttcatcggcgccggtaaaatggccgaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35392948 |
tcattcctctctctatcccttaaaccaaacatggaaatcattccgatccccgccgattcctacacactcggtttcatcggcgccggtaaaatggccgaaa |
35392849 |
T |
 |
| Q |
209 |
g |
209 |
Q |
| |
|
| |
|
|
| T |
35392848 |
g |
35392848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University