View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10563_low_8 (Length: 218)
Name: NF10563_low_8
Description: NF10563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10563_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 47075187 - 47075054
Alignment:
| Q |
1 |
agatgacccttttctcaggccaacgatgaagggtgtggtgttgatgttagaaggagttactgatatagcaattcctccttgtccagattccggttatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075187 |
agatgacccttttctcaggccaacgatgaagggtgtggtgttgatgttagaaggagttactgatatagcaattcctccttgtccagattccggttatgca |
47075088 |
T |
|
| Q |
101 |
taaaagtaactgtttcagctgttcctcatatggc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
47075087 |
taaaagtaactgtttcagctgttcctcatgtggc |
47075054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 47069143 - 47069232
Alignment:
| Q |
1 |
agatgacccttttctcaggccaacgatgaagggtgtggtgttgatgttagaaggagttactgatatagcaattcctccttgtccagattc |
90 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
47069143 |
agatgacccttttctcaggccaacaatgaagggtgtggtgttgatgttagaagggattactgatatagcaattcctccgtgtccaaattc |
47069232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 47086596 - 47086556
Alignment:
| Q |
8 |
ccttttctcaggccaacgatgaagggtgtggtgttgatgtt |
48 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
47086596 |
ccttttctcaggccaacaatgaagggtgtgttgttgatgtt |
47086556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 8 - 45
Target Start/End: Complemental strand, 47086760 - 47086723
Alignment:
| Q |
8 |
ccttttctcaggccaacgatgaagggtgtggtgttgat |
45 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
47086760 |
ccttttctcaggccaacaatgaagggtgtgttgttgat |
47086723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University