View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10564_9 (Length: 345)
Name: NF10564_9
Description: NF10564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10564_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 43244510 - 43244792
Alignment:
| Q |
1 |
attataatttacatttttaacaactatgagcctgtgccctgtggtagtggctgatttgtt-------gtatccacgaggagggggctacaaatatatata |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43244510 |
attataatttacatttttaacaactatgagcctgtgccctgtggtagtggctgatttgttatttgttgtatccacgaggagggggctacaaatatatata |
43244609 |
T |
 |
| Q |
94 |
cgtgaagattatacacaacatatgtgcagatcatttggctaac-----atgagatctttcatgacatatactagattcatatcctttgtctctatcccaa |
188 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43244610 |
cttgaagattatacacaacatatgcgcagatcatttggctaacgtaacatgagatctttcatgacatatactcgattcatatcctttgtctctatcccaa |
43244709 |
T |
 |
| Q |
189 |
gtcaatgcaattgtacaacactcttttatgaatttaatatgcaaatgcaagggaacggataattgccaaagtgttctatattt |
271 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244710 |
gtcaatgcaattatacaacactcttttatgaatttaatatgcaaatgcaagggaacggataattgccaaagtgttctatattt |
43244792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University