View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_high_15 (Length: 249)
Name: NF10565_high_15
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 43191164 - 43191395
Alignment:
| Q |
1 |
tttggaccatgaaacttgtgagatttgtgcatagagaaagcaagttgcttgtaatactttttcttatcacatactctgaatccgttt-ccttgtggg-at |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
43191164 |
tttggaccatgaaacttgtgagatttgtgcatagagaaagcaagttgcttgtaatactttttcttatcacatactctgaatccgttttccttgtggggat |
43191263 |
T |
 |
| Q |
99 |
ataaacaataaaaatttgaccatgttctagacttcattcaacttggaaattttgttgaggagtagtattgaattgaattctaccaagctcttttaacacc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43191264 |
ataaacaataaaaatttgaccatgttctagacttcattcaacttggaaattttgttgaggagtagtattgaattgaattctaccaagctcttttaacacc |
43191363 |
T |
 |
| Q |
199 |
cataacataacattattaactagaagcccgcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43191364 |
cataacataacattattaactagaagcccgcc |
43191395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University