View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_high_18 (Length: 206)
Name: NF10565_high_18
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 34500798 - 34500742
Alignment:
| Q |
132 |
atataaaatagtttataaatggggttaacccatttaatatgtattgcagttaaaatc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34500798 |
atataaaatagtttataaatggggttaacccatttaatatgtattgcagttaaaatc |
34500742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 34500912 - 34500873
Alignment:
| Q |
18 |
agatctggaaagtttgtaagaggcagactgagaaatttgg |
57 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34500912 |
agatctagaaagtttgtgagaggcagactgagaaatttgg |
34500873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 10215682 - 10215640
Alignment:
| Q |
18 |
agatctggaaagtttgtaagaggcagactgagaaatttgggtt |
60 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10215682 |
agatctggaaagtttgtgagaggcagactgagaaatttgggtt |
10215640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 10215568 - 10215505
Alignment:
| Q |
132 |
atataaaatagtttataaatggggttaaccc-------atttaatatgtattgcagttaaaatc |
188 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10215568 |
atataaaatattttataaatggggttaacccttaacccatttaatatgtattgcagttaaaatc |
10215505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 188
Target Start/End: Original strand, 49093790 - 49093846
Alignment:
| Q |
132 |
atataaaatagtttataaatggggttaacccatttaatatgtattgcagttaaaatc |
188 |
Q |
| |
|
||||||| ||| || ||||||||||||| ||||||| |||||| || |||||||||| |
|
|
| T |
49093790 |
atataaattagattttaaatggggttaaaccatttagtatgtaatgaagttaaaatc |
49093846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 176
Target Start/End: Original strand, 21373648 - 21373692
Alignment:
| Q |
132 |
atataaaatagtttataaatggggttaacccatttaatatgtatt |
176 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||||||||| |||| |
|
|
| T |
21373648 |
atataaaatagattttaaatggggttaaaccatttaatatctatt |
21373692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 176
Target Start/End: Complemental strand, 11764340 - 11764296
Alignment:
| Q |
132 |
atataaaatagtttataaatggggttaacccatttaatatgtatt |
176 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||||||||| |||| |
|
|
| T |
11764340 |
atataaaatagattttaaatggggttaaaccatttaatatctatt |
11764296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University