View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10565_high_8 (Length: 325)

Name: NF10565_high_8
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10565_high_8
NF10565_high_8
[»] chr5 (1 HSPs)
chr5 (1-199)||(41744247-41744445)


Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 41744247 - 41744445
Alignment:
1 atgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgggttgaggctccggctgaggaatgtatgag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
41744247 atgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgagttgaggctccggctgaggaatgtatgag 41744346  T
101 acgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgctgaggttactgcggctac 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
41744347 acgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgttgaggttactgcggctac 41744445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University