View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_high_8 (Length: 325)
Name: NF10565_high_8
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 41744247 - 41744445
Alignment:
| Q |
1 |
atgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgggttgaggctccggctgaggaatgtatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41744247 |
atgatatttataagaggattaatgctgcttattatggttatagggatgatgaagatgggatattggagcgagttgaggctccggctgaggaatgtatgag |
41744346 |
T |
|
| Q |
101 |
acgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgctgaggttactgcggctac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41744347 |
acgcgaggcggttgaggagtgggagaggttggataggataaggaaggaagctaggaaggctgtgaggagtggggaggttgttgaggttactgcggctac |
41744445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University