View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_low_21 (Length: 241)
Name: NF10565_low_21
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_low_21 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 44170275 - 44170499
Alignment:
| Q |
18 |
atgcacaagtcatgttttgagttatcttttctcttcccaagttttgacgattagtaggagacactgtatagtcaagggcattactcttactttagataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44170275 |
atgcacaagtcatgttttgagttatcttttctcttcccaagttttgacgattagtaggagacactgtatagtcaagggcattactcttactttagataaa |
44170374 |
T |
|
| Q |
118 |
aagaaatctaccacggctgttcaattccagcaaaatatgtggtcttatctcatgattgaaagtta-nnnnnnnngtttatgcaattctcctttatccnnn |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44170375 |
aagaaatctaccacggctgttcgattccagcaaaatatgtggtcttatctcatgattgaaagttattattttttgtttatgcaattctcctttatccttt |
44170474 |
T |
|
| Q |
217 |
nnnngtttctttcttcgggtttagt |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44170475 |
ttttgtttctttcttcgggtttagt |
44170499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 44170121 - 44170173
Alignment:
| Q |
20 |
gcacaagtcatgttttgagttatcttttctcttcccaagttttgacgattagt |
72 |
Q |
| |
|
||||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
44170121 |
gcacaagccatgttttgagttataaattatcttcccaagttttgacgattagt |
44170173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University