View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_low_23 (Length: 232)
Name: NF10565_low_23
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 51 - 148
Target Start/End: Complemental strand, 51664295 - 51664198
Alignment:
| Q |
51 |
ggtctatgtgtttttgtttttgcggtatcaccgtcgttccggtagtctcgatgttgctgtttctgttttggttgggctgatggtggtgtttacggatg |
148 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51664295 |
ggtctctgtgtttttgtttttgcggtatcaccgtcgttccggtagtctcgatgttgttgtttctattttggttgggctgatggtggtgtttacggatg |
51664198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 51664159 - 51664125
Alignment:
| Q |
187 |
ggacttcggtagtttggtatgtgttttcttgcttc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51664159 |
ggacttcggtagtttggtatgtgttttcttgcttc |
51664125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 59 - 148
Target Start/End: Original strand, 26762005 - 26762094
Alignment:
| Q |
59 |
tgtttttgtttttgcggtatcaccgtcgttccggtagtctcgatgttgctgtttctgttttggttgggctgatggtggtgtttacggatg |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
26762005 |
tgtttttgtttttgtggtatcaccgtcgttccggtagtctcgatgctgctgtttctgttttggcagggctgatggtggtgtttatggatg |
26762094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 185 - 221
Target Start/End: Original strand, 26762131 - 26762167
Alignment:
| Q |
185 |
tgggacttcggtagtttggtatgtgttttcttgcttc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26762131 |
tgggacttcggtagtttggtatgtgttttcttgcttc |
26762167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 51 - 114
Target Start/End: Complemental strand, 5950485 - 5950422
Alignment:
| Q |
51 |
ggtctatgtgtttttgtttttgcggtatcaccgtcgttccggtagtctcgatgttgctgtttct |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| || || || |||||||||||||| |
|
|
| T |
5950485 |
ggtctttgtgtttttgtttttgcggtatcgccgtcgttctcgtggtttcaatgttgctgtttct |
5950422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 216
Target Start/End: Complemental strand, 5950339 - 5950311
Alignment:
| Q |
188 |
gacttcggtagtttggtatgtgttttctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5950339 |
gacttcggtagtttggtatgtgttttctt |
5950311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University