View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10565_low_25 (Length: 207)
Name: NF10565_low_25
Description: NF10565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10565_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 3194855 - 3194674
Alignment:
| Q |
18 |
gtaagcagttaagaaaatagtgattaacaatttttggtgaatgagaattataaattctgaacaaaccaactgatcaatatatatactatgtgcatctgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3194855 |
gtaagcagttaagaaaatagtgattaacaatttttggtgaatgagaattacaaattctgaacaaaccaactgatcaatatatatactatgtgcatctgag |
3194756 |
T |
 |
| Q |
118 |
aatttgtgacaacaaaaacaaatgctcgttttaaactgcatactctactctgtttgttttaccctggatatctgtgctcctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3194755 |
aatttgtgacaacaaaaacaaatgctcgttttaaactgcatactctactctgtttgttttaccctggatatcagtgttcctc |
3194674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University