View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10566_low_8 (Length: 251)
Name: NF10566_low_8
Description: NF10566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10566_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 3821072 - 3821221
Alignment:
| Q |
1 |
atttttctttcacaatcaaattcgtttccagaattttgttttggcagtgagttttgctattgcaatggagatatgttggctgacattgttcatgggatgg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3821072 |
atttttctttcccaatcaaattcgtttccagaactttgttttggcagtgagttttgctattgcaatggagatatgttggctgacattgttcatgggatgg |
3821171 |
T |
 |
| Q |
101 |
actcgaggagaattaagaatagggtaagtttaacgtcaacttctccatta |
150 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3821172 |
actccaggagaattaaaaatagggtaagtttaacgtcaacttctccatta |
3821221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 159 - 240
Target Start/End: Original strand, 3821267 - 3821348
Alignment:
| Q |
159 |
ttgctggtttgttcttgctattcttttattcgcttgaagcatctaccacatcaattcttggtaaatttctatcttccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3821267 |
ttgctggtttgttcttgctattcttttattcgcttgaagcatctaccacatcaattcttggtaaatttctatcttccctatg |
3821348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 159 - 239
Target Start/End: Original strand, 29273830 - 29273911
Alignment:
| Q |
159 |
ttgctggtttgtt-cttgctattcttttattcgcttgaagcatctaccacatcaattcttggtaaatttctatcttccctat |
239 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| | ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29273830 |
ttgctggtttgtttcttgctgttcttttattcgatggaagcattgaccacatcaattcttggtaaatttctatcttccctat |
29273911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 159 - 239
Target Start/End: Complemental strand, 55860735 - 55860654
Alignment:
| Q |
159 |
ttgctggtttgtt-cttgctattcttttattcgcttgaagcatctaccacatcaattcttggtaaatttctatcttccctat |
239 |
Q |
| |
|
||||||||||||| |||||| |||||||||||| | ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55860735 |
ttgctggtttgtttcttgctgttcttttattcgatggaagcattgaccacatcaattctcggtaaatttctatcttccctat |
55860654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 148
Target Start/End: Complemental strand, 55860826 - 55860789
Alignment:
| Q |
111 |
aattaagaatagggtaagtttaacgtcaacttctccat |
148 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
55860826 |
aattaaggatagggtgagtttaacgtcaacttctccat |
55860789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University