View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10567_high_10 (Length: 239)

Name: NF10567_high_10
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10567_high_10
NF10567_high_10
[»] chr8 (2 HSPs)
chr8 (144-224)||(9422021-9422101)
chr8 (13-84)||(9422158-9422229)


Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 144 - 224
Target Start/End: Complemental strand, 9422101 - 9422021
Alignment:
144 ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaagaaagtcatggttat 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9422101 ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaagaaagtcatggttat 9422021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 84
Target Start/End: Complemental strand, 9422229 - 9422158
Alignment:
13 gatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatgaatattgaagaggaa 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9422229 gatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatgaatattgaagaggaa 9422158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University