View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_13 (Length: 302)
Name: NF10567_low_13
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 253
Target Start/End: Original strand, 11660073 - 11660322
Alignment:
| Q |
5 |
aaaagtattgtatgtttagttttctctttattatcttgatttggaagtctttaaaaagaaactatgtgtattacat-gattgcttctcaattctaaaaga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11660073 |
aaaagtattgtatgtttagttttctctttattatcttgatttggaagtctttaaaaagaaactatgtgtattacattgattgcttctcaattctaaaaga |
11660172 |
T |
 |
| Q |
104 |
ttttgttgtaacatctcatcatagagttactccccttgttaaggaggaaatttagaataagacttgttgtaggtggatcaaagaaaacattgatggtgct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11660173 |
ttttgttgtaacatctcatcatagagttactccccttgttaagcaggaaatttggaataagacttgttgtaggtggatcaaagaaaacattgatggtgct |
11660272 |
T |
 |
| Q |
204 |
atttgggtaagcctagttttgttagtgttagtgacatttttcaggacaat |
253 |
Q |
| |
|
|||||||||||||||||||||| | || ||||| |||||||||||||||| |
|
|
| T |
11660273 |
atttgggtaagcctagttttgtcaatgctagtggcatttttcaggacaat |
11660322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University