View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_14 (Length: 298)
Name: NF10567_low_14
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 291
Target Start/End: Complemental strand, 50227499 - 50227222
Alignment:
| Q |
20 |
tacttgaaagtagggatttgaaaccagatgtatactcatattctgctattgctggtgcttattcagatgtcagcaagatggaagaggctaggaagatctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50227499 |
tacttgaaagtagggatttgaaaccagatgtatactcatattctgctattgctagtgcttattcagatgtcggcaagatggaagaggctaggaagatctt |
50227400 |
T |
|
| Q |
120 |
agaagaagctaaaaagaatcatttaaagttatgccctgttaatgtatcacact------cgaggatattgcaagctggaacgatttgatgaggctttgga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50227399 |
agaagaagctaaaaagaatcatttaaagttatgccctgttaatgtatcacactctaatccgaggatattgcaagctggaacgatttgatgaggctttgga |
50227300 |
T |
|
| Q |
214 |
gttggtgtctgagatgaaaggttttggtgtctgcactactgctgatgattacaagaagttgatacagtctctctgctt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50227299 |
gttggtgtctgagatgaaaggttttggtgtctgcactactgctgatgattacaagaagttgatacagtctctctgctt |
50227222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 20 - 291
Target Start/End: Original strand, 36830135 - 36830411
Alignment:
| Q |
20 |
tacttgaaagtagggatttgaaaccagatgtatactcatattctgctattgctggtgcttattcagatgtcagcaagatggaagaggctaggaagatctt |
119 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| ||||||| ||||||| |||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
36830135 |
tacttgaaagtaggggtttgaaaccagatgtgtactcgtattctgttattgctagtgcttattcgaatggaggcgagatggaagaggctaggaagatctt |
36830234 |
T |
|
| Q |
120 |
agaagaagctaaaaagaatcatttaaagttatgccctgttaatgtatcacact------cgaggatattgcaagctggaacgatttgatgaggctttgga |
213 |
Q |
| |
|
|| ||||||||||||||||||| |||||| |||||| | |||||||||||| || ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
36830235 |
ggaggaagctaaaaagaatcattcgaagttaagccctg-tcatgtatcacactctaatccgcggatattgcaaattggaacggtttgatgaggctttgga |
36830333 |
T |
|
| Q |
214 |
gttggtgtctgagatgaaaggttttggtgtctgcactactgctgatgattacaagaagttgatacagtctctctgctt |
291 |
Q |
| |
|
|||| || |||||||||| | |||||| || | || |||||||||| ||| ||||| |||| |||||||||||||| |
|
|
| T |
36830334 |
gttgttgactgagatgaaggattttggggtacgtgcttctgctgatgaatacgagaagctgatccagtctctctgctt |
36830411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University