View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_16 (Length: 279)
Name: NF10567_low_16
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_16 |
 | |
|
| [»] scaffold0042 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 180 - 263
Target Start/End: Complemental strand, 41249121 - 41249038
Alignment:
| Q |
180 |
ggagcaactttgattggttgaattgtgtttcgtgactgatcacttcgagaagcttttcctcgagatatatagcagtgttggaaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41249121 |
ggagcaactttgattggttgaattgtgtttcgtgactgatcacttcgagaagcttttcctcgagatatatagcagtgctggaaa |
41249038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 12 - 95
Target Start/End: Complemental strand, 41249381 - 41249298
Alignment:
| Q |
12 |
ttggatacaatagtggatgttgagcattttaacttatgtcttaggttttggataaagatgttgtgttcaattcatttgtgtgat |
95 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
41249381 |
ttggatacaaaagtggatgttgagcattttaacttatgtgttaggttttggataaagttgttgtgttcaactcacttgtgtgat |
41249298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 97 - 155
Target Start/End: Complemental strand, 41249203 - 41249145
Alignment:
| Q |
97 |
gcttaaacgagttggcagcataacatcccttagattttacatttatttgatgaactgct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249203 |
gcttaaacgagttggcagcataacatcccttagattttacatttatttgatgaactgct |
41249145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 107 - 147
Target Start/End: Original strand, 89979 - 90019
Alignment:
| Q |
107 |
gttggcagcataacatcccttagattttacatttatttgat |
147 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
89979 |
gttggtagcataacataccttagattttacatttatttgat |
90019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 112 - 155
Target Start/End: Original strand, 34482473 - 34482516
Alignment:
| Q |
112 |
cagcataacatcccttagattttacatttatttgatgaactgct |
155 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
34482473 |
cagcataacatcctttagatttcacatttatttgatggactgct |
34482516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University