View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_19 (Length: 250)
Name: NF10567_low_19
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 159
Target Start/End: Complemental strand, 10553962 - 10553823
Alignment:
| Q |
18 |
atttatacattgaatatcgatattaaaatctgactttttctgtcgatatcaacatgatatgattttacaaaagccatgtctgcctctcttaaggattaca |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10553962 |
atttatacattgaatatcgatatcaaaatctgactttttctgtcgatatcaacatgatatgattttacaaaagccatgtctgc--ctcttaaggattaca |
10553865 |
T |
|
| Q |
118 |
tatgagatccattcaactgaggcaactgaaatcatcacttta |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10553864 |
tatgagatccattcaactgaggcaactgaaatcatcacttta |
10553823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 210 - 239
Target Start/End: Complemental strand, 10553438 - 10553409
Alignment:
| Q |
210 |
tttacattctgaattattcatgcaattcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10553438 |
tttacattctgaattattcatgcaattcat |
10553409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University