View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_21 (Length: 240)
Name: NF10567_low_21
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 88 - 226
Target Start/End: Original strand, 18747008 - 18747146
Alignment:
| Q |
88 |
aaaagtgaaaacgtggtgtccaacaagatgttattaacttgctttgactggttttcaggctcatagatttgcaattgtctctttagctagcagggaacta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18747008 |
aaaagtgaaaacgtggtgtccaacaagatgttattaacttgctttgactggttttcatgctcatagatttgcaattgtctctttagctagcagggaacta |
18747107 |
T |
|
| Q |
188 |
ttcttttgcggaatacaacttattggtagagggggaagc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18747108 |
ttcttttgcggaatacaacttattggtagagggggaagc |
18747146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 84
Target Start/End: Original strand, 18745657 - 18745730
Alignment:
| Q |
11 |
cagagagaaccatttaccgtcatgcctttatgtgtgatatatttggcttttaactggtttgttaagattccagg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18745657 |
cagagagaaccatttaccgtcatgcctttatgtgtgatatatttggcttttaactggtttgttatgattccagg |
18745730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University