View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_23 (Length: 239)
Name: NF10567_low_23
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 144 - 224
Target Start/End: Complemental strand, 9422101 - 9422021
Alignment:
| Q |
144 |
ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaagaaagtcatggttat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422101 |
ggtggaatagttagaggaataatagtacttgccccaagcaggaccaccagggtgagaccaataaaagaaagtcatggttat |
9422021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 13 - 84
Target Start/End: Complemental strand, 9422229 - 9422158
Alignment:
| Q |
13 |
gatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatgaatattgaagaggaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422229 |
gatgaagacataagattcatgcttccaaatagaggatacccttttggaccaggaatgaatattgaagaggaa |
9422158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University