View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_25 (Length: 233)
Name: NF10567_low_25
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29712858 - 29712637
Alignment:
| Q |
1 |
atttcgcaaattcacattttcaacttactgccaaaacacacgctcctagaattctattgataactccaaatctggaatctctatctattgatttggaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29712858 |
atttcgcaaattcacattttcaacttaccgccaaaacacacgctcctagaattctattgataactccaaatctggaatctctatctattgatttggaaac |
29712759 |
T |
|
| Q |
101 |
atcactctacgatgatagtgcttcctattcattgaatattaattttttgcttccacagtcttttacacaacttgatattaaaggttcgtgtagagggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29712758 |
atcactctacgatgatagtgcttcctattcattgaatattaattttttgcttccacagtcttttacacaacttgatattaaaggttcgtgtagagggttt |
29712659 |
T |
|
| Q |
201 |
atacttttgagttgtggttcat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29712658 |
atacttttgagttgtggttcat |
29712637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 6 - 131
Target Start/End: Original strand, 29687745 - 29687870
Alignment:
| Q |
6 |
gcaaattcacattttcaacttactgccaaaacacacgctcctagaattctattgataactccaaatctggaatctctatctattgatttggaaacatcac |
105 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| ||||||||||||| || |||| |||| |||| |||||||||||||| ||||| |||||||| | |
|
|
| T |
29687745 |
gcaaattctcattttcaacttaccgccaatgcacacactcctagaattctgttcataaatccagatcttgaatctctatctatagattttgaaacatcgc |
29687844 |
T |
|
| Q |
106 |
tctacgatgatagtgcttcctattca |
131 |
Q |
| |
|
| |||||||||||||||| |||||| |
|
|
| T |
29687845 |
ttcacgatgatagtgcttcttattca |
29687870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 42562547 - 42562506
Alignment:
| Q |
177 |
attaaaggttcgtgtagagggtttatacttttgagttgtggt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42562547 |
attaaaggttcgtgtagagggtttatacttttgcattgtggt |
42562506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 170 - 210
Target Start/End: Original strand, 29696064 - 29696104
Alignment:
| Q |
170 |
acttgatattaaaggttcgtgtagagggtttatacttttga |
210 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
29696064 |
acttgattttaaaggttcgtgtagaggctttatacttttga |
29696104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 47452129 - 47452085
Alignment:
| Q |
171 |
cttgatattaaaggttcgtgtagagggtttatacttttgagttgt |
215 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
47452129 |
cttgaaattaaaggttcatgtagagggtttatacttttaagttgt |
47452085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 209
Target Start/End: Original strand, 7771261 - 7771298
Alignment:
| Q |
172 |
ttgatattaaaggttcgtgtagagggtttatacttttg |
209 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7771261 |
ttgaaattagaggttcgtgtagagggtttatacttttg |
7771298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 209
Target Start/End: Original strand, 7904890 - 7904927
Alignment:
| Q |
172 |
ttgatattaaaggttcgtgtagagggtttatacttttg |
209 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7904890 |
ttgaaattagaggttcgtgtagagggtttatacttttg |
7904927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Complemental strand, 7774042 - 7774010
Alignment:
| Q |
177 |
attaaaggttcgtgtagagggtttatacttttg |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
7774042 |
attagaggttcgtgtagagggtttatacttttg |
7774010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 209
Target Start/End: Original strand, 7789951 - 7789983
Alignment:
| Q |
177 |
attaaaggttcgtgtagagggtttatacttttg |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
7789951 |
attagaggttcgtgtagagggtttatacttttg |
7789983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University