View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_30 (Length: 215)
Name: NF10567_low_30
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 34866444 - 34866398
Alignment:
| Q |
158 |
cttgttaaggtgatttcctttagaagcaacctttgttacacaggttc |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
34866444 |
cttgttagggtgatttcctttagaagcaacctctgttacacgggttc |
34866398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 34389375 - 34389343
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
34389375 |
ggtgatttcctttagaagcaacctctgttacac |
34389343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 47326282 - 47326250
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47326282 |
ggtgatttcctttagaagcaacctttgttacac |
47326250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 10243871 - 10243903
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
10243871 |
ggtgatttcctttagaagcaacctctgttacac |
10243903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 47235399 - 47235431
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47235399 |
ggtgatttcctttagaagcaacctttgttacac |
47235431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 20611467 - 20611499
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
20611467 |
ggtgatttcctttagaagcaacctctgttacac |
20611499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 45163532 - 45163564
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
45163532 |
ggtgatttcctttagaagcaatctttgttacac |
45163564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 20113918 - 20113880
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacacaggttc |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20113918 |
ggtgatttcctttagaagcaacctatgttacacgggttc |
20113880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 195
Target Start/End: Complemental strand, 24450329 - 24450300
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgtta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24450329 |
ggtgatttcctttagaagcaacctttgtta |
24450300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 46693216 - 46693184
Alignment:
| Q |
166 |
ggtgatttcctttagaagcaacctttgttacac |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
46693216 |
ggtgatttcctttagaagcaacctctgttacac |
46693184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University