View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10567_low_31 (Length: 202)
Name: NF10567_low_31
Description: NF10567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10567_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 89 - 148
Target Start/End: Complemental strand, 49754998 - 49754939
Alignment:
| Q |
89 |
atatgcttcttgcaatagaaacagtttggtatgtgttgaccaatagggatgaattcggta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49754998 |
atatgcttcttgcaatagaaacagtttggcatgtgttgaccaatagggatgaattcggta |
49754939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 60
Target Start/End: Complemental strand, 49755121 - 49755076
Alignment:
| Q |
15 |
aagggaggagtaatacatgctatcgccacattctcatgtcatgttt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49755121 |
aagggaggagtaatacatgctatcgccacattctcatgtcatgttt |
49755076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University