View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10569_16 (Length: 316)
Name: NF10569_16
Description: NF10569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10569_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 5 - 160
Target Start/End: Complemental strand, 36061341 - 36061186
Alignment:
| Q |
5 |
tatacttcgtcagagaaataataaagaaatcaatccacaaatgaataaaaaataagagtgaacatatatctaacggataagaagttagagtcttaattca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36061341 |
tatacttcgtcagagaaataataaagaaatcaatccacaaatgaataaaaaataagagtgaatatatatctaacggataagaaattagagtcttaattca |
36061242 |
T |
|
| Q |
105 |
atctcaaacaaataagnnnnnnnttaatctgataactaatcattaacttttgcaat |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36061241 |
atctcaaacaaataagaaaaaaattaatctgataactaatcattaacttttgcaat |
36061186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 36061117 - 36061042
Alignment:
| Q |
229 |
cattattgttaggaatgcatt-tcaaaattttgacgcccttaccttacggcatcggtgacgcacgtcccattattc |
303 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36061117 |
cattattgttaggtatgcattctcaaaattttgacgcccttatcttacggcatcggtgacgcacgtcccattattc |
36061042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University