View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_38 (Length: 358)
Name: NF1056_high_38
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 174 - 351
Target Start/End: Original strand, 18185307 - 18185479
Alignment:
| Q |
174 |
gagattgcgtattagcgtgtttgcattgcgcacgtacatatgacttggaattggataataacatggtaagttataatccctttgttagtaattaccttat |
273 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185307 |
gagattgcgtaggagcgtgtttgcattgcgcac----atatgacttggaattggataataacatcgtaagttataatccctttgttagtaattaccttat |
18185402 |
T |
 |
| Q |
274 |
gggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18185403 |
gggg-agttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctttggtg |
18185479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 275 - 351
Target Start/End: Complemental strand, 38833396 - 38833320
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38833396 |
ggggagttttggaaggtctccggtgtgcaaaacgtatggggttcactgcagtagaattaaatgtggattctttggtg |
38833320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 18185272 - 18185309
Alignment:
| Q |
30 |
cctatgagggaaagaaatttttttgcaacccctatgag |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185272 |
cctatgagggaaagaaatttttttgcaacccctatgag |
18185309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 275 - 351
Target Start/End: Original strand, 39180669 - 39180745
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39180669 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctttggtg |
39180745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 275 - 351
Target Start/End: Complemental strand, 20633298 - 20633222
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20633298 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctttggtg |
20633222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 275 - 351
Target Start/End: Complemental strand, 48823329 - 48823253
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
48823329 |
ggggagttttggaaggtctccggtgtgcaaaacgtacagggttcactgcagtagaattaaatatggattctttggtg |
48823253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 275 - 351
Target Start/End: Original strand, 16237338 - 16237414
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16237338 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctctggtg |
16237414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 7e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 275 - 351
Target Start/End: Complemental strand, 28575106 - 28575030
Alignment:
| Q |
275 |
ggggagttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28575106 |
ggggagttttggaaggtctccgatgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctctggtg |
28575030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 38658365 - 38658303
Alignment:
| Q |
281 |
ttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggatt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| | ||||| |||||| | ||||||| |
|
|
| T |
38658365 |
ttttggaaggtctccggtgtgcgaaacgaatggggtttatagcagttgaattacaagtggatt |
38658303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 279 - 351
Target Start/End: Original strand, 18568778 - 18568849
Alignment:
| Q |
279 |
agttttggaaggtctccggtgtgcgaaacgtatggggttcactgcagtagaattaaatgtggattctgtggtg |
351 |
Q |
| |
|
|||||||||||||||| | ||||| |||| ||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
18568778 |
agttttggaaggtctc-gatgtgcaaaacatatggggttcactgcagtatacttaaatgtggattctttggtg |
18568849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University