View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_42 (Length: 338)
Name: NF1056_high_42
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 41564691 - 41564914
Alignment:
| Q |
17 |
atgttggcgtgttggtgaagaaagaagatgtcgagagggctatagagaagttgatggatgacacgaattatgaaagtgaagagagaagaaaaagagctaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41564691 |
atgttggcgtgttggtgaagaaagaagatgtcgagagggctatagagaagttgatgaatgacacgaattatgaaagtgaagagagaagaaaaagagctaa |
41564790 |
T |
|
| Q |
117 |
ggagcttgcagagatggctaagaaaggtgtagaagaaggaggatcttctcacttcaatgtcacactattgattcaagatatccttcaacactcaacagag |
216 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41564791 |
ggagcttgcagatatggctaagaaaggtgtagaagaaggaggatcttctcacttcaatgtcacactattgattcaagatatccttcaacactcaacagag |
41564890 |
T |
|
| Q |
217 |
tagattgatgttgtttgcaacatt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41564891 |
tagattgatgttgtttgcaacatt |
41564914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University