View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_43 (Length: 331)
Name: NF1056_high_43
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 90 - 280
Target Start/End: Complemental strand, 29947879 - 29947689
Alignment:
| Q |
90 |
gctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgacaacgatgaca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29947879 |
gctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgacaacgatggca |
29947780 |
T |
 |
| Q |
190 |
tggattgctacagccggaaggaatcttctgatcaagagtctgattttagaggcgacctttctgatagcagttggcggtgtgatgagcctga |
280 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947779 |
tggatcgctacagccggaaggaatcttctgatcaagagtctgattttagaggcgacctttctgatagcagttggcggtgtgatgagcctga |
29947689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 89 - 180
Target Start/End: Original strand, 39776980 - 39777071
Alignment:
| Q |
89 |
agctgttgcttcaatgtgtgttcacctggaggtcactaagagaccctttatgggcgaagttgtgcaggctcttaagttgatattcaatgaca |
180 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||| || ||||||| |||||||| |||||||||||||||||||| || |||| |||||||| |
|
|
| T |
39776980 |
agctattgcgtcaatgtgtgttcactccgaggtgacacagagaccttttatgggagaagttgtgcaggctcttaaattaatatacaatgaca |
39777071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University