View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_66 (Length: 256)
Name: NF1056_high_66
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 30 - 241
Target Start/End: Complemental strand, 37095634 - 37095420
Alignment:
| Q |
30 |
ttttgttctggattctgacagattcgttgctcttgtggtaaatgaggtgacgaagtgtgtgactctcacattcaagtgtatctttgactcacaacaataa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| | |
|
|
| T |
37095634 |
ttttgttctggattctgacagattcgttgctcttgtggtaaatgaggtgacgaagtgtgtgactctcacattcatgtgtttctttgactcacaacaat-a |
37095536 |
T |
 |
| Q |
130 |
ccatattcttgagatctagaacctcacaactttggatacgtttgcatttgatcatggaaatagagt----attatttggtttaatttttcttcttgaaat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
37095535 |
ccatattcttgagatctagaacctcacaactttggatacgtttgcatttgatcatggaaatagagtagtgattatattgtttaatttttcttcttgaaat |
37095436 |
T |
 |
| Q |
226 |
gatccatattaatatt |
241 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37095435 |
gatccatattaatatt |
37095420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University