View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_69 (Length: 252)
Name: NF1056_high_69
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_69 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 30 - 243
Target Start/End: Original strand, 11065308 - 11065521
Alignment:
| Q |
30 |
aaggagagcataaaccaatttcattgcctgcaaaacnnnnnnnngcaccaattagtagaaaattaaggtatatgtgactctacaattctatgaaatcata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11065308 |
aaggagagcataaaccaatttcattgcctgcaaaacaaaaaaaagcaccaattagtagaaaattaaggtatatgtgactctacaattctatgaaatcata |
11065407 |
T |
|
| Q |
130 |
ataaatttgacgaaattccaaagtatatgttctaccaaaatcatgatggcacatcatgattctgctaaatcacaatgaatacgacgaaaccatgatgaca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11065408 |
ataaatttgacgaaattccaaagtatatgttctaccaaaatcatgatggcacatcatgattctggtaaatcacaatgaatacgacgaaaccatgatgaca |
11065507 |
T |
|
| Q |
230 |
ctgtgattttgttg |
243 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11065508 |
ctgtgattttgttg |
11065521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University