View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_70 (Length: 252)
Name: NF1056_high_70
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 44605116 - 44605234
Alignment:
| Q |
8 |
ccaacaatattgtgataaatatggtcaatttaaattaagggaccaaattgatgataaatatggttgtggtctttttaaaattggagaccttctagtctct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
44605116 |
ccaacaatattgtgataaatatggtcaatttaaattaagggacaaaattgatgataaatatggttgcggtccttttaaaattggagaccttctagtctct |
44605215 |
T |
|
| Q |
108 |
attagtacacgtttttagt |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44605216 |
attagtacacgtttttagt |
44605234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 252
Target Start/End: Original strand, 44605277 - 44605365
Alignment:
| Q |
163 |
ctttagatatcaacaattcatgt--tggatcaattcataaataatatgtttgttatgtcttcaatttgacccctgctagtagaggcttggaa |
252 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44605277 |
ctttagatatcaacaatttatgtgttggatcaattcataaata---tgtttgttatgtcttcaatttgacccctgctagtagaggcttggaa |
44605365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University