View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_73 (Length: 251)
Name: NF1056_high_73
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 16 - 133
Target Start/End: Original strand, 47591846 - 47591963
Alignment:
| Q |
16 |
atttagacaagtgttagttaaaatggatatgtcaaattattcaaaatacaatagtgaaagtgaatctggttggactaattacttgaaccattcatctttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47591846 |
atttagacaagtgttagttaaaatggatatgtcaaattattcaaaatacaatagtgaaagtgaatctggttggactaattacttgaaccattcatctttt |
47591945 |
T |
|
| Q |
116 |
tctgaagaacatttcaat |
133 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47591946 |
tctgaagaacatttcaat |
47591963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 47592044 - 47592087
Alignment:
| Q |
208 |
tttatccatggtttctgatgcttcttctggacctcctcagtact |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47592044 |
tttatccatggtttctgatgcttcttctggacctccacagtact |
47592087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University