View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_high_78 (Length: 238)
Name: NF1056_high_78
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_high_78 |
 | |
|
| [»] scaffold0568 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 136 - 225
Target Start/End: Complemental strand, 47501290 - 47501201
Alignment:
| Q |
136 |
ttcactaggcttccgtaaagtatgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaactgccatgcgttgtcccct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47501290 |
ttcactaggcttccgtaaagtatgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaattgccatgcgttgtcccct |
47501201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: scaffold0568
Description:
Target: scaffold0568; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 107
Target Start/End: Original strand, 2304 - 2380
Alignment:
| Q |
31 |
cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggttctg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2304 |
cctacctgttgccattatttgacccaaatataactcccaaaaatgtggttataattgcaaaattttgacaggttctg |
2380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 107
Target Start/End: Original strand, 8906 - 8982
Alignment:
| Q |
31 |
cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggttctg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8906 |
cctacctgttgccattatttgacccaaatataactcccaaaaatgtggttataattgcaaaattttgacaggttctg |
8982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 17060328 - 17060401
Alignment:
| Q |
31 |
cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgtaaaattttgacaggtt |
104 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
17060328 |
cctacctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattgcaaaattttgaccggtt |
17060401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 87
Target Start/End: Original strand, 29158133 - 29158189
Alignment:
| Q |
31 |
cctagctgttgccattatttgacccaaatatatctcccaaaaatgtggttataattg |
87 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
29158133 |
cctacctgttgccaatatttgacccaaatatatctcccagaaatgtggctataattg |
29158189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University