View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1056_low_103 (Length: 236)

Name: NF1056_low_103
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1056_low_103
NF1056_low_103
[»] chr4 (1 HSPs)
chr4 (30-164)||(19276917-19277053)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 30 - 164
Target Start/End: Complemental strand, 19277053 - 19276917
Alignment:
30 gtcttggtttaggagacaaaaagagagagaga--ttaactaaacaacagtgacaaacaaataatagtactagtagttgtttatattaaattaacaaaacc 127  Q
    ||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
19277053 gtcttggtttaggagacaaaaagagagagagagattaactaaacaacagtgacaaacaaataatagtactagtagttgtttacattaaattaacaaaacc 19276954  T
128 ttttgttgaggtgatttggcttttgattgattctgtg 164  Q
    |||||||||||||||||||||||||||||||||||||    
19276953 ttttgttgaggtgatttggcttttgattgattctgtg 19276917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University