View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_108 (Length: 206)
Name: NF1056_low_108
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_108 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 19277053 - 19276917
Alignment:
| Q |
54 |
gtcttggtttaggagacaaaaagagagagaga--ttaactaaacaacagtgacaaacaaataatagtactagtagttgtttatattaaattaacaaaacc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19277053 |
gtcttggtttaggagacaaaaagagagagagagattaactaaacaacagtgacaaacaaataatagtactagtagttgtttacattaaattaacaaaacc |
19276954 |
T |
|
| Q |
152 |
ttttgctgaggtgatttggcttttgattgattctgtg |
188 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19276953 |
ttttgttgaggtgatttggcttttgattgattctgtg |
19276917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University