View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_22 (Length: 470)
Name: NF1056_low_22
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 1e-85; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 123 - 372
Target Start/End: Original strand, 11362099 - 11362350
Alignment:
| Q |
123 |
ataaaatattttgaagaaagttgatgaatatttaatgcttggttgttgttgaaaagttgatgaatgtgattttgtatgtagaagattattataagaannn |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11362099 |
ataaaatattttgaagaaagttgatgaatatttaaagcttggttgttgttgaaaagttgatgaatgtgattttgtatgtagaagattattataagatttt |
11362198 |
T |
 |
| Q |
223 |
nnnnnnnnn----aagaaaatattagtgggtaggttttttattagtagggatcgaattctagacttttacatactcctttcacgttccaactcatacaac |
318 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11362199 |
ttattttatttttaagaagatattagtgggtag-ttttttattagtagagatcgaattctagacctttacatactcctttcacgttccaactcatacaac |
11362297 |
T |
 |
| Q |
319 |
tgagttacgcattcggggacgattatttactgtttgtaaccatagtgatgataa |
372 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11362298 |
tgagttacgcattc-gggacgattatttacggtttgtaaccatagtgatgataa |
11362350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 11361562 - 11361635
Alignment:
| Q |
19 |
aataaattgggaagtaataggaagaaaattttccagtgttgttattttgtttttgattagttctccacttaaac |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11361562 |
aataaattgggaagtaataggaagaaaattttccagtgtttttattttgtttttgattagttctccacttaaac |
11361635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 89 - 121
Target Start/End: Original strand, 11361748 - 11361780
Alignment:
| Q |
89 |
aaacaaaggacattgtttttatttctatcaaaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11361748 |
aaacaaaggacattgtttttatttctatcaaaa |
11361780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University